Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU000411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sirt1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TAAGCGGCTTGAGGGTAATCAATACCTGTTTGTACCACCAAATCGTTACATATTCCACGGTGCTGAGGTATACTCAGACTCTGAAGATGACGTCTTGTCCTCTAGTTCCTGTGGCAGTAACAGTGACAGTGGCACATGCCAGAGTCCAAGTTTAGAAGAACCCTTGGAAGATGAAAGTGAAATTGAAGAATTCTACAATGGCTTGGAAGATGATACGGAGAGGCCCGAATGTGCTGGAGGATCTGGATTTGGAGCTGATGGAGGGGATCAAGAGGTTGTTAATGAAGCTATAGCTACAAGACAGGAATTGACAGATGTAAACTATCCATCAGACAAATCATAACACTATTGAAGCTGTCCGGATTCAGGAATTGCTCCACCAGCATTGGGAACTTTAGCA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jie-Ning Zhu et al.
Scientific reports, 7(1), 11879-11879 (2017-09-21)
The molecular mechanisms underlying anthracyclines-induced cardiotoxicity have not been well elucidated. MiRNAs were revealed dysregulated in the myocardium and plasma of rats received Dox treatment. MicroRNA-34a-5p (miR-34a-5p) was verified increased in the myocardium and plasma of Dox-treated rats, but was
Mickaël Ohanna et al.
Oncotarget, 5(8), 2085-2095 (2014-04-20)
SIRT1 operates as both a tumor suppressor and oncogenic factor depending on the cell context. Whether SIRT1 plays a role in melanoma biology remained poorly elucidated. Here, we demonstrate that SIRT1 is a critical regulator of melanoma cell proliferation. SIRT1
Xiwen Xiong et al.
PloS one, 14(2), e0212523-e0212523 (2019-02-23)
Nicotinamide phosphoribosyltransferase (NAMPT) is a rate-limiting enzyme in mammalian nicotinamide adenine dinucleotide (NAD)+ biosynthesis. Through its NAD+-biosynthetic activity, NAMPT influences the activity of NAD+-dependent enzymes, such as sirtuins. NAMPT is able to modulate processes involved in the pathogenesis of non-alcohol
Yi Fu et al.
Cell metabolism, 32(6), 1052-1062 (2020-11-14)
Lipid accumulation in podocytes is a major determinant of diabetic kidney disease (DKD) and identification of potential therapeutic targets by mediating podocyte lipid metabolism has clinical importance. This study was to elucidate the role of JAML (junctional adhesion molecule-like protein)
Yuanbang Lin et al.
Journal of natural medicines, 72(3), 715-723 (2018-04-24)
Berberine (BBR) has been demonstrated to protect against renal ischemia/reperfusion injury; however, the underlying molecular mechanism is largely unknown. In the present study, we examined the role of silent information regulator 1 (Sirt1)/p53 in the protective effect of BBR on

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico