Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU218961

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCGAGTCACACCAGAAAGCTAGGTCGTGGGTCAGCTCTGAGGATGTATACCCCTGGTGGGAGAGGGAGACCTAGAGATCTGGCTGTGGGGCGGGCATGGGGGGTGAAGGGCCACTGGGACCCTCAGCCTTGTTTGTACTGTATGCCTTCAGCATTGCCTAGGAACACGAAGCACGATCAGTCCATCCCAGAGGGACCGGAGTTATGACAAGCTTTCCAAATATTTTGCTTTATCAGCCGATATCAACACTTGTATCTGGCCTCTGTGCCCCAGCAGTGCCTTGTGCAATGTGAATGTGCGCGTCTCTGCTAAACCACCATTTTATTTGGTTTTTGTTTTGTTTTGGTTTTGCTCGGATACTTGCCAAAATGAGACTCTCCGTCGGCAGCTGGGGGAAGGGTCTGAGACTCCCTTTCCTTTTGGTTTTGGGATTACTTTTGATCCTGGGGGACCAATGAGGTGAGGGGGGTTCTCCTTTGCCCTCAGCT

Ensembl | nº de acceso humano

ENSG00000245848

Nº de acceso NCBI

NM_004364

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CEBPA(1050) , CEBPA(1050)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ana Rita Lourenço et al.
Nature communications, 11(1), 785-785 (2020-02-09)
Extracellular signals such as TGF-β can induce epithelial-to-mesenchymal transition (EMT) in cancers of epithelial origin, promoting molecular and phenotypical changes resulting in pro-metastatic characteristics. We identified C/EBPα as one of the most TGF-β-mediated downregulated transcription factors in human mammary epithelial
Rui Su et al.
Cell, 172(1-2), 90-105 (2017-12-19)
R-2-hydroxyglutarate (R-2HG), produced at high levels by mutant isocitrate dehydrogenase 1/2 (IDH1/2) enzymes, was reported as an oncometabolite. We show here that R-2HG also exerts a broad anti-leukemic activity in vitro and in vivo by inhibiting leukemia cell proliferation/viability and by promoting
Wei Liu et al.
Respiratory research, 20(1), 281-281 (2019-12-13)
Fibroblasts regulate tissue homeostasis and the balance between tissue repair and fibrosis. CCAAT/enhancer-binding protein alpha (CEBPA) is a key transcription factor that regulates adipogenesis. CEBPA has been shown to be essential for lung maturation, and deficiency of CEBPA expression leads

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico