Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU157281

Sigma-Aldrich

MISSION® esiRNA

targeting human ALAS1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGGGGCAGTTATGGACACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACTAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACTTAGAGCGGGAGCTGGCAGACCTCCATGGGAAAGATGCCGCACTCTTGTTTTCCTCGTGCTTTGTGGCCAATGACTCAACCCTCTTCACCCTGGCTAAGATGATGCCAGGCTGTGAGATTTACTCTGATTCTGGGAACCATGCCTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTACATCTTCCGCCACAATGATGTCAGCCACCTCAGAGAACTGCTGCAAAGATCTGACCCCTCAGTCCCCAAGATTGTGGCATTTGAAACTGTCCATTCAATGGATGGGGCGGTGTGCCCACTGGAAGAGCTGTGTGATGTGGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yalei Zhao et al.
Saudi journal of gastroenterology : official journal of the Saudi Gastroenterology Association, 26(3), 144-152 (2020-04-10)
Colorectal cancer (CRC) is the third most common malignant tumour worldwide and the second leading cause of cancer-related deaths. Commonly, 5'-aminolevulinic acid synthase1 (ALAS1) is the rate-limiting enzyme for haem biosynthesis. Recent studies have shown that ALAS1 is involved in
Taka-Aki Takeda et al.
Biochimica et biophysica acta, 1861(7), 1813-1824 (2017-03-30)
The degradation of heme significantly contributes to cytoprotective effects against oxidative stress and inflammation. The enzyme heme oxygenase-1 (HO-1), involved in the degradation of heme, forms carbon monoxide (CO), ferrous iron, and bilirubin in conjunction with biliverdin reductase, and is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico