Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU155171

Sigma-Aldrich

MISSION® esiRNA

targeting human PPP2CA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATCCAACGTGCAAGAGGTTCGATGTCCAGTTACTGTCTGTGGAGATGTGCATGGGCAATTTCATGATCTCATGGAACTGTTTAGAATTGGTGGCAAATCACCAGATACAAATTACTTGTTTATGGGAGATTATGTTGACAGAGGATATTATTCAGTTGAAACAGTTACACTGCTTGTAGCTCTTAAGGTTCGTTACCGTGAACGCATCACCATTCTTCGAGGGAATCATGAGAGCAGACAGATCACACAAGTTTATGGTTTCTATGATGAATGTTTAAGAAAATATGGAAATGCAAATGTTTGGAAATATTTTACAGATCTTTTTGACTATCTTCCTCTCACTGCCTTGGTGGATGGGCAGATCTTCTGTCTACATGGTGGTCTCTCGCCATCTATAGATACACTGGATCATATCAGAGCACTTGATCGCCTACAAGAAGTTCCCCATGAGGGTCCAATGTGTGACTTGCTGTGGTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fei Xie et al.
Life sciences, 257, 118086-118086 (2020-07-18)
To investigate the role of PP2A in calcified aortic valve disease (CAVD). The expressions of PP2A subunits were detected by real-time polymerase chain reaction (RT-PCR) and western blot in aortic valves from patients with CAVD and normal controls, the activities
Md Mostafizur Rahman et al.
Scientific reports, 5, 10063-10063 (2015-05-20)
PP2A is a master controller of multiple inflammatory signaling pathways. It is a target in asthma; however the molecular mechanisms by which PP2A controls inflammation warrant further investigation. In A549 lung epithelial cells in vitro we show that inhibition of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico