Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU154671

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM2A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAAGGCACTTGAAGGAAAGCCAGACTGAATCAACAAATGCCATCTTGGAGATGCAGTACCCTAAAGTGCAGAAGTACTGTCTAATGAGTGTTCGAGGCTGCTATACTGACTTCCATGTGGACTTTGGTGGTACCTCTGTTTGGTATCACATCCATCAAGGGGGAAAGGTCTTCTGGCTCATCCCCCCTACAGCCCACAACCTGGAGCTGTACGAGAATTGGCTGCTGTCAGGGAAACAGGGAGACATCTTTCTGGGTGACCGGGTATCAGATTGTCAGCGCATTGAGCTCAAGCAGGGCTATACCTTCGTCATTCCCTCAGGCTGGATTCATGCTGTGTATACTCCTACAGACACATTAGTGTTTGGGGGCAATTTTTTGCATAGCTTCAACATCCCTATGCAGTTAAAAATATACAACATTGAAGATCGGACACGGGTTCCAAATAAGTTTCGCTATCCATTCTACTATGAGATGTGTTGGTATGTGTTGGAGCGCTATGTGTACTGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dan-Hua Lu et al.
Oncology reports, 41(2), 917-927 (2018-11-30)
Metastasis is the most common cause of death in ovarian cancer patients but remains largely untreated. Epithelial‑mesenchymal transition (EMT) is critical for the conversion of early‑stage ovarian tumors into metastatic malignancies. Thus, investigating the signaling pathways promoting EMT may identify
Mei Yang et al.
Cell reports, 31(12), 107803-107803 (2020-06-25)
The function of enhancer RNAs (eRNAs) in transcriptional regulation remains obscure. By analyzing the genome-wide nascent transcript profiles in breast cancer cells, we identify a special group of eRNAs that are essential for estrogen-induced transcriptional repression. Using eRNAs of TM4SF1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico