Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU154611

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNA3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGTTCTCCTTCGAACTGCTGGTGCGGTTCTTCGCTTGTCCTAGCAAAGCCACCTTCTCGCGAAACATCATGAACCTGATCGACATTGTGGCCATCATTCCTTATTTTATCACTCTGGGTACCGAGCTGGCCGAACGACAGGGCAATGGACAGCAGGCCATGTCTCTGGCCATCCTGAGGGTCATCCGCCTGGTAAGGGTCTTCCGCATCTTCAAGCTGTCGCGCCACTCCAAGGGGCTGCAGATCCTCGGGCAAACGCTGAAGGCGTCCATGCGGGAGCTGGGATTGCTCATCTTCTTCCTCTTTATTGGGGTCATCCTTTTCTCCAGCGCGGTCTACTTTGCCGAGGCAGACGACCCCACTTCAGGTTTCAGCAGCATCCCGGATGCCTTCTGGTGGGCAGTGGTAACCATGACAACAGTGGGTTACGGCGATATGCACCCAGTGACCATAGGGGGCAAGATTGTGGGATCTCTCTGTGCCATCGCCGGTGTCTTGACCATCGCATTG

Ensembl | nº de acceso humano

ENSG00000177272

Nº de acceso NCBI

NM_002232

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KCNA3(3738) , KCNA3(3738)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiao-Hong Kan et al.
Archives of biochemistry and biophysics, 591, 150-156 (2016-01-10)
Ion channels expressed in macrophages have been tightly related to atherosclerosis by coupling cellular function. How the voltage-gated potassium channels (Kv) affect macrophage migration remain unknown. The aim of our study is to investigate whether Kv1.3-ERK signaling pathway plays an
Marat Khodoun et al.
Science advances, 6(47) (2020-11-20)
Lupus nephritis (LN) is an autoimmune disease with substantial morbidity/mortality and limited efficacy of available therapies. Memory T (Tm) lymphocytes infiltrate LN kidneys, contributing to organ damage. Analysis of LN, diabetic nephropathy, and healthy donor kidney biopsies revealed high infiltration
Roberta Peruzzo et al.
Redox biology, 37, 101705-101705 (2020-10-03)
The potassium channel Kv1.3, involved in several important pathologies, is the target of a family of psoralen-based drugs whose mechanism of action is not fully understood. Here we provide evidence for a physical interaction of the mitochondria-located Kv1.3 (mtKv1.3) and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico