Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU154031

Sigma-Aldrich

MISSION® esiRNA

targeting human PYGB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACTCGGAGATCGTGAAACAGTCGGTCTTTAAGGATTTTTATGAACTGGAGCCAGAGAAGTTCCAGAATAAGACCAATGGCATCACCCCCCGCCGGTGGCTGCTGCTGTGCAACCCGGGGCTGGCCGATACCATCGTGGAGAAAATTGGGGAGGAGTTCCTGACTGACCTGAGCCAGCTGAAGAAGCTGCTGCCGCTGGTCAGTGACGAGGTGTTCATCAGGGACGTGGCCAAGGTCAAACAGGAGAACAAGCTCAAGTTCTCGGCCTTCCTGGAGAAGGAGTACAAGGTGAAGATCAACCCCTCCTCCATGTTCGATGTGCATGTGAAGAGGATCCACGAGTACAAGCGGCAGCTGCTCAACTGCCTGCACGTCGTCACCCTGTACAATCGAATCAAGAGAGACCCGGCCAAGGCTTTTGTGCCCAGGACTGTTATGATTGGGGGCAAGGCAGCGCCCGGTTACCACATGGCCAAGCTGATCATCAAGTTGGTCACCTCCATCGGCGACGTCGTCAATCATGACCCAGTTGTGGGTGACAGGTTGAAA

Ensembl | nº de acceso humano

ENSG00000100994

Nº de acceso NCBI

NM_002862

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PYGB(5834) , PYGB(5834)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhen Wang et al.
Molecular medicine reports, 18(4), 3800-3808 (2018-08-15)
Brain‑type glycogen phosphorylase (PYGB) is an enzyme that metabolizes glycogen, whose function is to provide energy for an organism in an emergency state. The present study purposed to investigate the role and mechanism of PYGB silencing on the growth and
Liang Wang et al.
Technology in cancer research & treatment, 19, 1533033820905832-1533033820905832 (2020-02-08)
To explore the clinical value of ultrasound in the diagnosis of medullary thyroid carcinoma by comparing with enhanced computed tomography. This retrospective study was performed on 62 patients with pathologically confirmed medullary thyroid carcinoma. All patients underwent ultrasound and enhanced

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico