Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU153761

Sigma-Aldrich

MISSION® esiRNA

targeting human EFNB3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGCAGAGGGTGGTTATGTGCTGTACCCTCAGATCGGGGACCGGCTAGACCTGCTCTGCCCCCGGGCCCGGCCTCCTGGCCCTCACTCCTCTCCTAATTATGAGTTCTACAAGCTGTACCTGGTAGGGGGTGCTCAGGGCCGGCGCTGTGAGGCACCCCCTGCCCCAAACCTCCTTCTCACTTGTGATCGCCCAGACCTGGATCTCCGCTTCACCATCAAGTTCCAGGAGTATAGCCCTAATCTCTGGGGCCACGAGTTCCGCTCGCACCACGATTACTACATCATTGCCACATCGGATGGGACCCGGGAGGGCCTGGAGAGCCTGCAGGGAGGTGTGTGCCTAACCAGAGGCATGAAGGTGCTTCTCCGAGTGGGACAAAGTCCCCGAGGAGGGGCTGTCCCCCGAAAACCTGTGTCTGAAATGCCCATGGAAAGAGA

Ensembl | nº de acceso humano

ENSG00000108947

Nº de acceso NCBI

NM_001406

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EFNB3(1949) , EFNB3(1949)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Judith Rudolph et al.
Frontiers in cellular neuroscience, 8, 185-185 (2014-08-08)
During embryonic development the preoptic area (POA) gives rise to two populations of neurons which are generated at the same time, cortical interneurons and striatal cells. POA-derived cortical interneurons take a superficial path and avoid the developing striatum (Str) when
Amélie Royet et al.
Oncotarget, 8(14), 23750-23759 (2017-04-21)
EphA4, an Ephrins tyrosine kinase receptor, behaves as a dependence receptor (DR) by triggering cell apoptosis in the absence of its ligand Ephrin-B3. DRs act as conditional tumor suppressors, engaging cell death based on ligand availability; this mechanism is bypassed
Hiroko Sugiura et al.
Nature communications, 6, 6842-6842 (2015-04-17)
Rheb is a small GTP-binding protein and its GTPase activity is activated by the complex of Tsc1 and Tsc2 whose mutations cause tuberous sclerosis complex (TSC). We previously reported that cultured TSC neurons showed impaired spine synapse morphogenesis in an

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico