Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU153641

Sigma-Aldrich

MISSION® esiRNA

targeting human HRH4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGAATGGGCCAATGATTCTAGTTTCAGAGTCTTGGAAGGATGAAGGTAGTGAATGTGAACCTGGATTTTTTTCGGAATGGTACATCCTTGCCATCACATCATTCTTGGAATTCGTGATCCCAGTCATCTTAGTCGCTTATTTCAACATGAATATTTATTGGAGCCTGTGGAAGCGTGATCATCTCAGTAGGTGCCAAAGCCATCCTGGACTGACTGCTGTCTCTTCCAACATCTGTGGACACTCATTCAGAGGTAGACTATCTTCAAGGAGATCTCTTTCTGCATCGACAGAAGTTCCTGCATCCTTTCATTCAGAGAGACAGAGGAGAAAGAGTAGTCTCATGTTTTCCTCAAGAACCAAGATGAATAGCAATACAATTGCTTCCAAAATGGGTTCCTTCTCCCAATCAGATTCTGTAGCTCTTCACCAAAGGGAACA

Ensembl | nº de acceso humano

ENSG00000134489

Nº de acceso NCBI

NM_001160166

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HRH4(59340) , HRH4(59340)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 38(3), 204-212 (2018-06-05)
Mast cell (MC) activation through H4R releases various inflammatory mediators which are associated with allergic asthma. To investigate the siRNA-mediated gene silencing effect of H4R on human mast cells (HMCs) functions and the activation of stress-activated protein kinases (SAPK)/jun amino-terminal
Anne-France Petit-Bertron et al.
PloS one, 4(8), e6504-e6504 (2009-08-08)
The most recently characterized H4 histamine receptor (H4R) is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional
Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 37(2), 133-140 (2016-07-13)
The histamine H4 receptor functionally expressed on human mast cells and their signaling pathways for the production of IL-13 and RANTES have never been analyzed side by side in a directly comparable manner. Therefore, the aim of the study was
Ya-Xin Zhao et al.
American journal of physiology. Endocrinology and metabolism, 317(6), E1158-E1171 (2019-09-25)
Although many studies have shown that histamine and its signaling regulate energy homeostasis through the central nervous system, their roles in adipose tissues remain poorly understood. Here, we identified that the histamine H4 receptor (HrH4) was highly expressed in adipocytes

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico