Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU152941

Sigma-Aldrich

MISSION® esiRNA

targeting human PSPC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGAAAGGCTCTGGAAAGATGTGGTGATGGGGCATTCTTGCTAACAACGACCCCTCGTCCAGTCATTGTGGAACCCATGGAGCAGTTTGATGATGAAGATGGCTTGCCAGAGAAGCTGATGCAGAAAACTCAACAATATCATAAGGAAAGAGAACAACCACCACGTTTTGCTCAACCTGGGACATTTGAATTTGAGTATGCATCTCGATGGAAGGCTCTTGATGAAATGGAAAAGCAGCAGCGTGAGCAGGTTGATAGAAACATCAGAGAAGCCAAAGAGAAACTGGAGGCAGAAATGGAAGCAGCTAGGCATGAACACCAATTAATGCTAATGAGGCAAGATCTAATGAGGCGTCAAGAAGAACTCAGACGCTTGGAAGAACTCAGAAACCAAGAGTTGCAAAAACGG

Ensembl | nº de acceso humano

ENSG00000121390

Nº de acceso NCBI

NM_001042414

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PSPC1(55269) , PSPC1(55269)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ziqiang Wang et al.
Cellular and molecular life sciences : CMLS, 74(6), 1117-1131 (2016-10-27)
Nuclear paraspeckle assembly transcript 1 (NEAT1) is the crucial structural platform of paraspeckles, which is one type of nuclear bodies. As a stress-induced lncRNA, the expression of NEAT1 increases in response to viral infection, but little is known about the
Hsin-Wei Jen et al.
Cells, 9(6) (2020-06-24)
Paraspeckle protein 1 (PSPC1) overexpression in cancers is known to be the pro-metastatic switch of tumor progression associated with poor prognosis of cancer patients. However, the detail molecular mechanisms to facilitate cancer cell migration remain elusive. Here, we conducted integrated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico