Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU152641

Sigma-Aldrich

MISSION® esiRNA

targeting human LAIR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGGAGACAAGAGCTGGAGACTGGAGGTTTCTAACCAGCATCCAGAAGGTTCGTTAGCCAGGTGGTCCCTTCTACAATCGAGCAGCTCCTTGGACAGACTGTTTCTCAGTTATTTCCAGAGACCCAGCTACAGTTCCCTGGCTGTTTCTAGAGACCCAGCTTTATTCACCTGACTGTTTCCAGAGACCCAGCTAAAGTCACCTGCCTGTTCTAAAGGCCCAGCTACAGCCAATCAGCCGATTTCCTGAGCAGTGATGCCACCTCCAAGCTTGTCCTAGGTGTCTGCTGTGAACCTCCAGTGACCCCAGAGACTTTGCTGTAATTATCTGCCCTGCTGACCCTAAAGACCTTCCTAGAAGTCAAGAGCTAGCCTTGAGACTGTGCTATACACACACAGCTGAGAGCCAAGCCCAGTTCTCT

Ensembl | nº de acceso humano

ENSG00000167613

Nº de acceso NCBI

NM_002287

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LAIR1(3903) , LAIR1(3903)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
NJU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ying Zhang et al.
Microbial pathogenesis, 109, 292-299 (2017-06-20)
Helicobacter pylori is a Gram-negative, microaerophilic bacteria usually found in the stomach, which may evade its host's immune system and present long-term symptoms in affected individuals. This study aimed to evaluate the functional role of leukocyte-associated immunoglobulin (Ig)-like receptor-1 (LAIR-1)
Guofeng Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1050-1059 (2019-03-08)
Vascular remodeling is a critical event following a stroke. It is a well known fact that  C1q is the first molecule in the complement classical pathway. However, its role in the neovascularization that ocurs after a stroke, remains unclear. In
Chitra Joseph et al.
Cancers, 13(1) (2021-01-06)
The leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) plays a role in immune response homeostasis, extracellular matrix remodelling and it is overexpressed in many high-grade cancers. This study aimed to elucidate the biological and prognostic role of LAIR-1 in invasive breast cancer (BC).

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico