Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU151801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGAAGGATCTCGGCCAATTTGGGGTTTTGGGTTTTGGCTTCGTTTCTTCTCTTCGTTGACTTTGGGGTTCAGGTGCCCCAGCTGCTTCGGGCTGCCGAGGACCTTCTGGGCCCCCACATTAATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACC

Ensembl | nº de acceso humano

ENSG00000136826

Nº de acceso NCBI

NM_004235

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KLF4(9314) , KLF4(9314)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
NAV
UTU
ITU
JQU
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Takuya Nagata et al.
Breast cancer (Tokyo, Japan), 24(2), 326-335 (2016-06-15)
Prognosis of breast cancer patients has been reported to depend on the expression of induced pluripotent stem (iPS) cell-inducing factors: KLF4 and NANOG. However, the relationship between KLF4 or NANOG expression in each breast cancer subtype and the life prognosis
Scott Bell et al.
American journal of human genetics, 104(5), 815-834 (2019-04-30)
We identified individuals with variations in ACTL6B, a component of the chromatin remodeling machinery including the BAF complex. Ten individuals harbored bi-allelic mutations and presented with global developmental delay, epileptic encephalopathy, and spasticity, and ten individuals with de novo heterozygous
Bing Li et al.
Human gene therapy, 30(3), 339-351 (2018-09-13)
Kallistatin (KS) has been recognized as a plasma protein with anti-inflammatory functions. Macrophages are the primary inflammatory cells in atherosclerotic plaques. However, it is unknown whether KS plays a role in macrophage development and the pathogenesis of atherosclerosis. This study
Guodong Tang et al.
Oncotarget, 7(49), 81757-81767 (2016-11-12)
In this study, our findings indicated that FOXO1 expression frequently decreased in glioma tissues and cells. FOXO1 expression decrease correlated with glioma progression and predicted a worse overall survival of glioma patients. Restored FOXO1 expression inhibited glioma cells invasion and
Renzhi Yu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 39(6), 1010428317705574-1010428317705574 (2017-06-21)
Non-small cell lung cancer is one of the most common epithelial tumors that cause the most common cancer-related mortality due to invasive ability. Research has found that Kruppel-like factor 4, a zinc-finger transcription factor, plays a critical role in the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico