Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU150691

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC9A3R2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCGACAAGGACACTGAGGATGGCAGTGCCTGGAAGCAAGATCCCTTCCAGGAGAGCGGCCTCCACCTGAGCCCCACGGCGGCCGAGAGGAGAAGGCTCGAGCCATGCGAGTCAACAAGCGCGCGCCACAGATGGACTGGAACAGGAAGCGTGAAATCTTCAGCAACTTCTGAGCCCCTTCCTGCCTGTCTCGGGACCCTGGGACCCCTCCCGCACGGACCTTGGGCCTCAGCCTGCCCCGAGCTCCCCCAGCCTCAGTGGACTGGAGGGTGGTCCTGCCATTGCCCAGAAATCAGCCCCAGCCCCGGTGAGCCCCCATCCTGCCCCTGCCCACCAGGTACTGGGGGCCTGTGGCAGCAAGATAGGGGGAGAGAGACCCAGAGATGTGAGAGAGAGTCAGAGACAGAGACAGAGAGAGAGAGAGAGAGACACAGAGAGAGACAGAGAGAGAGCGAGCGAG

Ensembl | nº de acceso humano

ENSG00000065054

Nº de acceso NCBI

NM_001130012

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SLC9A3R2(9351) , SLC9A3R2(9351)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ursula Storch et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(1), E37-E46 (2016-12-21)
The activation mechanism of the classical transient receptor potential channels TRPC4 and -5 via the Gq/11 protein-phospholipase C (PLC) signaling pathway has remained elusive so far. In contrast to all other TRPC channels, the PLC product diacylglycerol (DAG) is not
Ivan Meneses-Morales et al.
Nucleic acids research, 42(11), 6885-6900 (2014-04-29)
The estrogen receptor alpha (ERα) is a ligand-activated transcription factor that possesses two activating domains designated AF-1 and AF-2 that mediate its transcriptional activity. The role of AF-2 is to recruit coregulator protein complexes capable of modifying chromatin condensation status.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico