Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU148691

Sigma-Aldrich

MISSION® esiRNA

targeting human ALOX5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGCAAGTACTGGCTGAATGACGACTGGTACCTGAAGTACATCACGCTGAAGACGCCCCACGGGGACTACATCGAGTTCCCCTGCTACCGCTGGATCACCGGCGATGTCGAGGTTGTCCTGAGGGATGGACGCGCAAAGTTGGCCCGAGATGACCAAATTCACATTCTCAAGCAACACCGACGTAAAGAACTGGAAACACGGCAAAAACAATATCGATGGATGGAGTGGAACCCTGGCTTCCCCTTGAGCATCGATGCCAAATGCCACAAGGATTTACCCCGTGATATCCAGTTTGATAGTGAAAAAGGAGTGGACTTTGTTCTGAATTACTCCAAAGCGATGGAGAACCTGTTCATCAACCGCTTCATGCACATGTTCCAGTCTTCTTGGAATGACTTCGCCGACTTTGAGAAA

Ensembl | nº de acceso humano

ENSG00000012779

Nº de acceso NCBI

NM_000698

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ALOX5(240) , ALOX5(240)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alana N Vagnozzi et al.
Translational psychiatry, 7(12), 1288-1288 (2017-12-19)
Neurodegenerative tauopathies are characterized by pathological accumulation of highly phosphorylated isoforms of tau protein, which leads to progressive neuronal loss. Neuroinflammation often accompanies tau-driven diseases; however, the direct role of neuroinflammation in tauopathies remains unknown. The 5-lipoxygenase (5LO) is a
Bishuang Cai et al.
Science signaling, 11(549) (2018-09-27)
Inflammation resolution counterbalances excessive inflammation and restores tissue homeostasis after injury. Failure of resolution contributes to the pathology of numerous chronic inflammatory diseases. Resolution is mediated by endogenous specialized proresolving mediators (SPMs), which are derived from long-chain fatty acids by
Hyun Jeong Kwak et al.
Scientific reports, 7(1), 5025-5025 (2017-07-12)
Leukotriene B4 (LTB4) production via the 5-lipoxygenase (5-LO) pathway contributes to the development of insulin resistance in adipose and hepatic tissues, but the role of LTB4 in skeletal muscle is relatively unknown. Here, the authors investigated the role of LTB4
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
Olga Scherer et al.
Journal of immunological methods, 422, 118-124 (2015-04-22)
Monocytes are an important constituent of the innate immune system. Therefore, manipulating gene expression of primary human monocytes is a crucial mean to study and characterize the functions of targeted proteins in monocytes. Gene silencing by transfection of cells with
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico