Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU147361

Sigma-Aldrich

MISSION® esiRNA

targeting human ANP32A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAAAGTGTCCGAACCTCACGCATCTAAATTTAAGTGGCAACAAAATTAAAGACCTCAGCACAATAGAGCCACTGAAAAAGTTAGAAAACCTCAAGAGCTTAGACCTTTTCAATTGCGAGGTAACCAACCTGAACGACTACCGAGAAAATGTGTTCAAGCTCCTCCCGCAACTCACATATCTCGACGGCTATGACCGGGACGACAAGGAGGCCCCTGACTCGGATGCTGAGGGCTACGTGGAGGGCCTGGATGATGAGGAGGAGGATGAGGATGAGGAGGAGTATGATGAAGATGCTCAGGTAGTGGAAGACGAGGAGGACGAGGATGAGGAGGAGGAAGGTGAAGAGGAGGACGTGAGTGGAGAGGAGGAGGAGGATGAAGAAGGTTATAACGATGGAGAGGTAGATGACGAGGAAGATGAAGAAGAGCTTGGTGAAGAAGAAAGGGGTCAGAAGCGAAAACGAGAACCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bharath Kumar Velmurugan et al.
Oncotarget, 7(10), 10879-10890 (2016-02-27)
Acidic leucine-rich nuclear phosphoprotein-32A (ANP32A) is a multifunctional protein aberrantly expressed in various types of cancers. However, its expression pattern and clinical significance in oral squamous cell carcinoma (OSCC) remains unclear. In this study, we immunohistochemically investigated the expression pattern
Timothy K Williams et al.
PloS one, 5(11), e15455-e15455 (2010-12-15)
The expression of protein phosphatase 32 (PP32, ANP32A) is low in poorly differentiated pancreatic cancers and is linked to the levels of HuR (ELAV1), a predictive marker for gemcitabine response. In pancreatic cancer cells, exogenous overexpression of pp32 inhibited cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico