Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU145171

Sigma-Aldrich

MISSION® esiRNA

targeting human IL10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGAGACATCAGGGTGGC

Ensembl | nº de acceso humano

ENSG00000136634

Nº de acceso NCBI

NM_000572

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IL10(3586) , IL10(3586)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hyeon-Soo Lee et al.
Journal of cellular and molecular medicine, 19(7), 1538-1547 (2015-06-11)
Although the mechanisms by which hyperoxia promotes bronchopulmonary dysplasia are not fully defined, the inability to maintain optimal interleukin (IL)-10 levels in response to injury secondary to hyperoxia seems to play an important role. We previously defined that hyperoxia decreased
Sandip Mukherjee et al.
Journal of immunology (Baltimore, Md. : 1950), 193(8), 4083-4094 (2014-09-14)
The efflux of antimony through multidrug resistance protein (MDR)-1 is the key factor in the failure of metalloid treatment in kala-azar patients infected with antimony-resistant Leishmania donovani (Sb(R)LD). Previously we showed that MDR-1 upregulation in Sb(R)LD infection is IL-10-dependent. Imipramine
Rodrigo Liberal et al.
Hepatology (Baltimore, Md.), 62(3), 863-875 (2015-05-09)
Defective immune regulation plays a permissive role enabling effector cells to initiate and perpetuate tissue damage, eventually resulting in autoimmune disease. Numerical and functional regulatory T-cell (Treg) impairment has been previously reported in autoimmune liver disease (AILD; including autoimmune hepatitis

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico