Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU144201

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC2A2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCAGCTACCGACAGCCTATTCTAGTGGCACTGATGCTGCATGTGGCTCAGCAATTTTCCGGAATCAATGGCATTTTTTACTACTCAACCAGCATTTTTCAGACGGCTGGTATCAGCAAACCTGTTTATGCAACCATTGGAGTTGGCGCTGTAAACATGGTTTTCACTGCTGTCTCTGTATTCCTTGTGGAGAAGGCAGGGCGACGTTCTCTCTTTCTAATTGGAATGAGTGGGATGTTTGTTTGTGCCATCTTCATGTCAGTGGGACTTGTGCTGCTGAATAAGTTCTCTTGGATGAGTTATGTGAGCATGATAGCCATCTTCCTCTTTGTCAGCTTCTTTGAAATTGGGCCAGGCCCGATCCCCTGGTTCATGGTGGCTGAGTTTTTCAGTCAAGGACCACGTCCTGCTGCTTTAGCAATAGCTGCATTCAGCAATTGGACCTGCAATTTCATTGTAGCTCTGTGTTTCCAGTACATTGCGGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jin-Yong Lee et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(1), e21236-e21236 (2020-12-19)
Cadmium (Cd) is an environmental contaminant that causes renal toxicity. We have previously demonstrated that Cd induces renal toxicity by altering transcriptional activities. In this study, we show that Cd markedly inhibited the activity of transcription factor MEF2A in HK-2
Qiao Zhang et al.
Diabetes research and clinical practice, 142, 363-373 (2018-06-26)
High levels of circulating free fatty acids (FFAs), inflammation and oxidative stress are important causes for insulin resistance (IR) and type 2 diabetes mellitus. The aim of this study was to investigate the mechanisms of EGCG in alleviating IR in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico