Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU143671

Sigma-Aldrich

MISSION® esiRNA

targeting human PIAS4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCGGAGTAAGAGTGGACTGAAGCACGAGCTCGTCACCAGGGCCCTCCAGCTGGTGCAGTTTGACTGTAGCCCTGAGCTGTTCAAGAAGATCAAGGAGCTGTACGAGACCCGCTACGCCAAGAAGAACTCGGAGCCTGCCCCACAGCCGCACCGGCCCCTGGACCCCCTGACCATGCACTCCACCTACGACCGGGCCGGCGCTGTGCCCAGGACTCCGCTGGCAGGCCCCAATATTGACTACCCCGTGCTCTACGGAAAGTACTTAAACGGACTGGGACGGTTGCCCGCCAAGACCCTCAAGCCAGAAGTCCGCCTGGTGAAGCTGCCGTTCTTTAATATGCTGGATGAGCTGCTGAAGCCCACCGAATTAGTCCCACAGAACAACGAGAAGCTTCAGGAGAGCCCGTGCATCTTCGCATTGACGCCAAGACAGGTGGAGTTGATCCGGAACTCCAGGGAACTGCAGCCCGGAGTTAAAGCCGTGCAGGTC

Ensembl | nº de acceso humano

ENSG00000105229

Nº de acceso NCBI

NM_015897

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PIAS4(51588) , PIAS4(51588)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoyan Gong et al.
Molecular biology of the cell, 30(1), 4-16 (2018-11-08)
A pathway for cystic fibrosis transmembrane conductance regulator (CFTR) degradation is initiated by Hsp27, which cooperates with Ubc9 and binds to the common F508del mutant to modify it with SUMO-2/3. These SUMO paralogues form polychains, which are recognized by the
Ronghua Wang et al.
Oncotarget, 8(41), 70142-70155 (2017-10-21)
The small ubiquitin-related modifier (SUMO) system is essential for smooth progression of cell cycle at the G2/M phase. Many centromeric proteins are reversibly SUMOylated to ensure proper chromosome segregation at the mitosis. SUMOylation of centromeric Origin Recognition Complex subunit 2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico