Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU143551

Sigma-Aldrich

MISSION® esiRNA

targeting human FAM134B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGGACCTTCAACCTTTCAGAAGGATACACTCCACAGACAGACACTTCTGATGATCTTGACCGACCCAGTGAGGAAGTTTTCTCTAGAGATCTTTCAGATTTTCCATCTCTAGAAAATGGCATGGGAACAAATGATGAAGATGAATTAAGCCTTGGTTTGCCCACTGAGCTCAAGAGAAAGAAGGAACAGTTGGACAGTGGTCACAGACCAAGCAAAGAGACGCAATCAGCAGCTGGTCTCACCCTTCCTCTGAACAGTGACCAAACCTTTCACCTGATGAGCAACCTGGCTGGGGATGTTATCACAGCTGCAGTGACTGCAGCTATCAAAGACCAGTTAGAGGGTGTGCAGCAAGCACTTTCTCAGGCTGCCCCCATCCCAGAAGAGGACACAGACACTGAAGAAGGTGATGACTTTGAACTACTTGACCAGTCAGAGCTGGATCAAATTGAGAGTGAATTGGGACTTACACAAGACCAGGAAGCAGAAGC

Ensembl | nº de acceso humano

ENSG00000154153

Nº de acceso NCBI

NM_001034850

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FAM134B(54463) , FAM134B(54463)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Farhadul Islam et al.
Molecular carcinogenesis, 56(1), 238-249 (2016-04-28)
The aims of the present study are to investigate sub-cellular location, differential expression in different cancer stages and functional role of FAM134B in colon cancer development. FAM134B expression was studied and quantified at protein and mRNA levels in cell lines
Zhao-Qi Zhang et al.
Molecular oncology, 13(4), 792-810 (2018-12-18)
Fam134b (JK-1, RETREG1) was first identified as an oncogene in esophageal squamous cell carcinoma. However, the roles of FAM134B during tumorigenesis of hepatocellular carcinoma (HCC) and in epithelial-to-mesenchymal transition (EMT) were previously unclear. In this study, we investigated the function

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico