Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU143531

Sigma-Aldrich

MISSION® esiRNA

targeting human SRGN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCACCCTGCTACATTTCCTAATCAAGAAGTTGGCGTGCAGCTGGGAGAGCTAGACTAAGTTGGTCATGATGCAGAAGCTACTCAAATGCAGTCGGCTTGTCCTGGCTCTTGCCCTCATCCTGGTTCTGGAATCCTCAGTTCAAGGTTATCCTACGCGGAGAGCCAGGTACCAATGGGTGCGCTGCAATCCAGACAGTAATTCTGCAAACTGCCTTGAAGAAAAAGGACCAATGTTCGAACTACTTCCAGGTGAATCCAACAAGATCCCCCGTCTGAGGACTGACCTTTTTCCAAAGACGAGAATCCAGGACTTGAATCGTATCTTCCCACTTTCTGAGGACTACTCTGGATCAGGCTTCGGCTCCGGCTCCGGCTCTGGATCAGGATCTGGGAGTGGCTTCCTAACGGAAATGGAACAGGATTACCAACTAGTAGACGAAAGTGATGCTTTCCATGACAACCTTAGGTCTCTTGACAGGAATCTGCCCTC

Ensembl | nº de acceso humano

ENSG00000122862

Nº de acceso NCBI

NM_002727

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SRGN(5552) , SRGN(5552)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qinfeng Ma et al.
Molecular and cellular biochemistry, 474(1-2), 15-26 (2020-07-28)
Endothelial cells (ECs) play an important role in the pathogenesis of cardiovascular disease, especially atherosclerosis (AS). The abnormal wall shear stress (WSS) which directly contacts with ECs is the key stimulating factor leading to AS. However, the underlying mechanism of
Angela D'Ascola et al.
Biochemical and biophysical research communications, 499(3), 506-512 (2018-03-29)
Serglycin is expressed by a variety of cell types and mediates different functions in both normal and pathological conditions by interacting with different biological molecules, such as the CD44 receptor. Many studies suggest that serglycin has a crucial role in
Michele Scuruchi et al.
Archives of biochemistry and biophysics, 669, 80-86 (2019-05-31)
Serglycin (SRGN) is an intracellular proteoglycan produced and secreted by several cell types. The increased expression of SRGN was associated with greater aggressiveness in cancer and inflammation. In this study, we demonstrated that SRGN is increased in human chondrocytes after

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico