Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU139771

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGCTTTCCATCCACTCACCTTACCCCATAGCATCTTGCGGCCCAGAAACCAGAGCCATTTGTCTCAGACCCTAAATCAATAATCACAAACCCCAAAACGGGAGAGAGCAGTGAAAACATGCAGGGCTGTGGACGGGGGAAGGGTTGTGGCGGGTGTTCTGAGGCTGAGAGGACACCTATATGCGTATTTCCTCTACACACATCACCCCCCTTCTATAATCTTAAGCCATGACTAGCCTGGTGGCGTGTTAGTTTCTGCCCAGTTCTACCCCCTCATGTGCTTCTTCTGAATACTGAATGTGACTGTTTGAAAGCTGGTAGAATTCATCCCTCTTACTGTAGATAACACTGCAAATCTTGGAATTTTGTTTTTTGCTGTTTCCAGATGTATCTATAAATATCTATACATTATATGTGTGTGTGTGTGTGTGTGTGTGTGTGTACATCGGGTCCTCC

Ensembl | nº de acceso humano

ENSG00000103034

Nº de acceso NCBI

NM_001130487

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NDRG4(65009) , NDRG4(65009)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hua Cheng et al.
Shock (Augusta, Ga.), 54(6), 802-809 (2020-03-19)
Myocardial ischemia reperfusion (IR) injury is a serious issue in the treatment of myocardial infarction. MiR-433 is upregulated in myocardial IR injury, but its specific effects remain unclear. In this study, we explored the effect and mechanism of miR-433 in
Yuan Xing et al.
Basic research in cardiology, 111(2), 11-11 (2016-01-19)
N-myc downstream-regulated gene 4 (NDRG4) is expressed weakly in heart and has been reported to modulate cardiac development and QT interval duration, but the role of NDRG4 in myocardial ischemia/reperfusion (I/R) injury remains unknown. In the present study, we analyzed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico