Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU137391

Sigma-Aldrich

MISSION® esiRNA

targeting human RECQL4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACGGCTCAACATGAAGCAGAAACACTACGTGCGGGGCCGGGCACTCCGTAGCAGGCTCCTCCGCAAGCAGGCATGGAAGCAGAAGTGGCGGAAGAAAGGGGAGTGTTTTGGGGGTGGTGGTGCCACAGTCACAACCAAGGAGTCTTGTTTCCTGAACGAGCAGTTCGATCACTGGGCAGCCCAGTGTCCCCGGCCAGCAAGTGAGGAAGACACAGATGCTGTTGGGCCTGAGCCACTGGTTCCTTCACCACAACCTGTACCTGAGGTGCCCAGCCTGGACCCCACCGTGCTGCCACTCTACTCCCTGGGGCCCTCAGGGCAGTTGGCAGAGACGCCGGCTGAGGTGTTCCAGGCCCTGGAGCAGCTGGGGCACCAAGCCTTTCGCCCTGGGCAGGAGCGTGCAGTCATGCGGATCCTGTCTGGCATCTCCAC

Ensembl | nº de acceso humano

ENSG00000160957

Nº de acceso NCBI

NM_004260

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RECQL4(9401) , RECQL4(9401)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alvin J M Ng et al.
PLoS genetics, 11(4), e1005160-e1005160 (2015-04-11)
RECQL4 mutations are associated with Rothmund Thomson Syndrome (RTS), RAPADILINO Syndrome and Baller-Gerold Syndrome. These patients display a range of benign skeletal abnormalities such as low bone mass. In addition, RTS patients have a highly increased incidence of osteosarcoma (OS).
Guosheng Lyu et al.
Cancer biology & medicine, 18(1), 120-138 (2021-02-26)
RECQL4 (a member of the RECQ helicase family) upregulation has been reported to be associated with tumor progression in several malignancies. However, whether RECQL4 sustains esophageal squamous cell carcinoma (ESCC) has not been elucidated. In this study, we determined the
Chen Qiao et al.
Oncotarget, 7(13), 17009-17020 (2016-03-10)
Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. We previously demonstrated that oroxylin A induced apoptosis in human colon cancer cells via the mitochondrial pathway. In the present study, we investigated the underlying mechanisms responsible
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico