Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU137061

Sigma-Aldrich

MISSION® esiRNA

targeting human SNX17

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGCAGCGAGACTTTCAACAGTTTCCTGCGTCGGGCACAACAGGAGACACAGCAGGTCCCCACAGAGGAAGTGTCCTTGGAAGTGCTGCTCAGCAACGGGCAGAAAGTTCTGGTCAACGTGCTAACTTCAGATCAGACTGAGGATGTCCTGGAGGCTGTAGCTGCAAAGCTGGATCTTCCAGATGACTTGATTGGATACTTTAGTCTATTCTTAGTTCGAGAAAAAGAGGATGGAGCCTTTTCTTTTGTACGGAAGTTGCAAGAGTTTGAGCTGCCTTATGTGTCTGTCACCAGCCTTCGGAGTCAAGAGTATAAGATTGTGCTAAGGAAGAGTTATTGGGACTCTGCCTATGATGACGATGTCATGGAGAACCGGGTTGGCCTGAACCTGCTTTATGCTCAGACGGTATCAGATATTGAGCGTGGGTGGAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

David Pim et al.
Journal of virology, 95(3) (2020-11-13)
Previous studies have identified an interaction between the human papillomavirus (HPV) L2 minor capsid protein and sorting nexins 17 and 27 (SNX17 and SNX27) during virus infection. Further studies show the involvement of both retromer and retriever complexes in this
Fuyao Liu et al.
Cell reports, 32(7), 108049-108049 (2020-08-20)
APC mutation activation of Wnt/β-catenin drives initiation of colorectal carcinogenesis (CRC). Additional factors potentiate β-catenin activation to promote CRC. Western diets are enriched in linoleic acid (LA); LA-enriched diets promote chemically induced CRC in rodents. 15-Lipoxygenase-1 (15-LOX-1), the main LA-metabolizing

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico