Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU136321

Sigma-Aldrich

MISSION® esiRNA

targeting human PACS2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGTGGACAAGTGGAGACAGACCTGGCCCTGACCTTCTCCTTGCAGTATCCTCACTTCTTGAAGAGGGAAGGCAACAAGCTTCAGATCATGCTGCAGCGCAGAAAGCGCTACAAGAACAGAACCATCCTGGGCTACAAGACGCTGGCCGCGGGCTCCATCAGCATGGCTGAGGTGATGCAACACCCGTCTGAAGGTGGCCAGGTGCTGAGCCTCTGCAGCAGCATCAAGGAGGCCCCCGTCAAGGCGGCCGAGATCTGGATCGCCTCCCTGTCCAGCCAGCCCATTGACCACGAAGACAGCACCATGCAGGCCGGCCCCAAGGCCAAGTCCACGGATAACTACTCCGAGGAGGAGTATGAGAGCTTCTCCTCCGAGCAGGAGGCCAGTGACGACGCCGTGCAGGGGCAGGACTTGGACGAGGACGACTTTGACGT

Ensembl | nº de acceso humano

ENSG00000179364

Nº de acceso NCBI

NM_001100913

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PACS2(23241) , PACS2(23241)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kyle Salka et al.
Scientific reports, 7(1), 16-16 (2017-02-06)
Most nuclear-encoded mitochondrial proteins traffic from the cytosol to mitochondria. Some of these proteins localize at mitochondria-associated membranes (MAM), where mitochondria are closely apposed with the endoplasmic reticulum (ER). We have previously shown that the human cytomegalovirus signal-anchored protein known
Sarah Louise Dombernowsky et al.
Nature communications, 6, 7518-7518 (2015-06-26)
The metalloproteinase ADAM17 activates ErbB signalling by releasing ligands from the cell surface, a key step underlying epithelial development, growth and tumour progression. However, mechanisms acutely controlling ADAM17 cell-surface availability to modulate the extent of ErbB ligand release are poorly

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico