Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU136041

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTCCTCAAGGTGCCATCCTATCTCAGCTACAAGTTTCTGGGCGAGCGTGATTGTGCTGCGCCCTGCGAACCTGCGCGGCCCGATGGTTCCATGTTCTTCTCACAGGAGGAGACGCGTTTCGCGCGCCTCTGGATCCTCACCTGGTCGGTGCTGTGCTGCGCTTCCACCTTCTTCACTGTCACCACGTACTTGGTAGACATGCAGCGCTTCCGCTACCCAGAGCGGCCTATCATTTTTCTGTCGGGCTGCTACACCATGGTGTCGGTGGCCTACATCGCGGGCTTCGTGCTCCAGGAGCGCGTGGTGTGCAACGAGCGCTTCTCCGAGGACGGTTACCGCACGGTGGTGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATGCTCTACTTCTTCAGCATGGCCAGCTCCATCTGGTGGGTCATCCTGTC

Ensembl | nº de acceso humano

ENSG00000180340

Nº de acceso NCBI

NM_001466

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FZD2(2535) , FZD2(2535)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiang Hu et al.
The Turkish journal of gastroenterology : the official journal of Turkish Society of Gastroenterology, 31(2), 167-179 (2020-03-07)
Autophagy plays a positive role in the prevention of liver damage after hepatic ischemia-reperfusion injury (HIRI); however, the molecular mechanism is still a mystery. Understanding the molecular events behind this injury may have important implications for devising proper strategies for
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that
Norihiro Chatani et al.
Liver international : official journal of the International Association for the Study of the Liver, 35(8), 2017-2026 (2014-12-10)
Obesity-related adipocytokine dysregulation is known to accelerate liver fibrosis progression. Recently, a natural Wnt5a inhibitor, secreted frizzled-related protein 5 (Sfrp5), was identified as a novel adipocytokine that has reduced expression in obese adipose tissue in both rodents and human. In

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico