Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU134811

Sigma-Aldrich

MISSION® esiRNA

targeting human HGF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGGCCATGAATTTGACCTCTATGAAAACAAAGACTACATTAGAAACTGCATCATTGGTAAAGGACGCAGCTACAAGGGAACAGTATCTATCACTAAGAGTGGCATCAAATGTCAGCCCTGGAGTTCCATGATACCACACGAACACAGCTTTTTGCCTTCGAGCTATCGGGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCTCGAGGGGAAGAAGGGGGACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTCTGTGACATTCCTCAGTGTTCAGAAGTTGAATGCATGACCTGCAATGGGGAGAGTTATCGAGGTCTCATGGATCATACAGAATCAGGCAAGATTTGTCAGCGCTGGGATCATCAGACACCACACCGGCACAAATTCTTGCCTGAAAGATATCCCGACAAGGGCT

Ensembl | nº de acceso humano

ENSG00000019991

Nº de acceso NCBI

NM_000601

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HGF(3082) , HGF(3082)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
WNS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Michihiko Nakamura et al.
Gynecologic oncology, 139(2), 345-354 (2015-09-04)
A current working model for the metastatic process of ovarian carcinoma suggests that cancer cells are shed from the ovarian tumor into the peritoneal cavity and attach to the layer of mesothelial cells that line the inner surface of the
Wei-Ping Tang et al.
Journal of gastroenterology and hepatology, 30(6), 1065-1074 (2015-02-03)
Recent studies show that adipose tissue-derived mesenchymal stem cells have potential clinical applications. However, the mechanism has not been fully elucidated yet. Here, we investigated the effect of basic fibroblast growth factor-treated adipose tissue-derived mesenchymal stem cells infusion on a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico