Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU134461

Sigma-Aldrich

MISSION® esiRNA

targeting human TREM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGATCTACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCAGGGACCCCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCCTTGTGCCCACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCCACTCCTGACTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGGTTCCGGTGTTCAACATTGTCATTCTCCTGGCTGGTGGATTCCTGAGTAAGAGCCTGGTCTTCTCTGTCCTGTTTGCTGTCACGCTGAGGTCATTTGTACCCTAGGCCCACGAACCCACGAGAATGTCCTCTGACTTCCAGCC

Ensembl | nº de acceso humano

ENSG00000124731

Nº de acceso NCBI

NM_018643

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TREM1(54210) , TREM1(54210)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoliang Zhang et al.
PloS one, 14(9), e0221991-e0221991 (2019-09-12)
This study aimed to examine the macrophage phenotype and its relationship to renal function and histological changes in human DN and the effect of TREM-1 on high-glucose-induced macrophage activation. We observed that in renal tissue biopsies, the expression of CD68
Danping Fan et al.
International journal of molecular sciences, 17(4), 498-498 (2016-04-07)
Triptolide (TP), an active component isolated from Tripterygiumwilfordii Hook F, has therapeutic potential against rheumatoid arthritis (RA). However, the underlying molecular mechanism has not been fully elucidated. The aim of this study is to investigate the mechanisms of TP acting
Jianfei Tang et al.
Biochemical and biophysical research communications, 482(4), 1240-1245 (2016-12-10)
Triggering receptor expressed on myeloid cells 1 (TREM-1) is a recently discovered molecule that modulates inflammatory responses. This study aimed to investigate the specific function of TREM-1 in chondrocytes and its association with the pathophysiology of osteoarthritis (OA). We observed
Mansoor Ali Syed et al.
American journal of respiratory cell and molecular biology, 60(3), 308-322 (2018-10-04)
Hyperoxia-induced injury to the developing lung, impaired alveolarization, and dysregulated vascularization are critical factors in the pathogenesis of bronchopulmonary dysplasia (BPD); however, mechanisms for hyperoxia-induced development of BPD are not fully known. In this study, we show that TREM-1 (triggering

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico