Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU133721

Sigma-Aldrich

MISSION® esiRNA

targeting human CASC2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGCAGATGGAGATTCAGAAACATAAGGACAACAAGAAACTTCCCCAAGGTATCATTATAGTCTTTAGACTTCAGACACACACCACACCTCAAATATATACACAACTGAAAGGAAAATTAAGGAAGTTTTTCAAAGAACCCTATTCCGAGTAAGAAGTGTGTTGCATGAATTTCTAAGAGCCAGAAAATGCATGACACAGGAGAAGATGTACCCTCATCTGTTCAGTGAGAGATGTGCAAATCAACATCAACACAGAACTGCTGAAGAAAAAAAATATGTCTCTGAAAAGCAACTTATTCACTGGAGATGTGAGGAGCCATCCGCACATCACAATTCTATAGACATCAAACGCATGAAGCATTTCGGATCTGCTTTAAGACTGAGGCAGACTTTCCATCTGGACACAGCCGACCATCCATGTGTCATTACAATGAATCCAGCACTTCCCTG

Ensembl | nº de acceso humano

ENSG00000177640

Nº de acceso NCBI

NR_026939

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CASC2(255082)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Y X Dai et al.
Journal of biological regulators and homeostatic agents, 34(1), 49-56 (2020-03-07)
Dysregulation of lncRNA cancer susceptibility candidate 2 (CASC2) is involved in the pathogenesis of multiple malignancies. However, the underlying mechanisms by which lncRNA CASC2 regulates the proliferation of hemangiomas (HAs) remain undocumented. Herein, the expression levels of lncRNA CASC2 and
Yufeng Wang et al.
Molecular cancer, 16(1), 123-123 (2017-07-19)
Recently, it has been reported that long non-coding RNA (lncRNA) cancer susceptibility candidate 2 (CASC2), a novel tumor suppressor, participates in regulating the carcinogenesis and suppresses tumor progression by sponging microRNAs (miRNAs). However, the expression and function of CASC2 in
Chenjing Wang et al.
Molecular medicine (Cambridge, Mass.), 26(1), 74-74 (2020-07-24)
Studies have demonstrated that long noncoding RNAs (lncRNAs) have essential impacts on the development of atherosclerosis (AS). This study aimed to identify the role and functional mechanism of lncRNA CASC2 in the development and migration of vascular smooth muscle cells
Qi-Yu Liu et al.
The Kaohsiung journal of medical sciences, 37(4), 268-275 (2020-12-19)
Long noncoding RNA (lncRNA) Cancer Susceptibility 2 (CASC2) has been proved to contribute to the development of cancers. However, the mechanism behind the action of CASC2 in thyroid cancer is not quite clear. We demonstrated that CASC2 was downregulated in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico