Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU132491

Sigma-Aldrich

MISSION® esiRNA

targeting human BTK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGCCATCAAGATGATCAAAGAAGGCTCCATGTCTGAAGATGAATTCATTGAAGAAGCCAAAGTCATGATGAATCTTTCCCATGAGAAGCTGGTGCAGTTGTATGGCGTCTGCACCAAGCAGCGCCCCATCTTCATCATCACTGAGTACATGGCCAATGGCTGCCTCCTGAACTACCTGAGGGAGATGCGCCACCGCTTCCAGACTCAGCAGCTGCTAGAGATGTGCAAGGATGTCTGTGAAGCCATGGAATACCTGGAGTCAAAGCAGTTCCTTCACCGAGACCTGGCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTTAAAGTATCTGATTTCGGCCTGTCCAGGTATGTCCTGGATGATGAATACACAAGCTCAGTAGGCTCCAAATTTCCAGTCCGGTGGTCCCCACCGGAAGTCCTGATGTATAGCAAGTTCAGCAGCAAATCTGACATTTGGGCTTTTGGGGTTTTGATGTGGGAAATTTACTCCCTGGGGAAGATGCCATATGAGAGATTTACTAACAGTGAGACTGCTGAACACATTGCCCAAGGCCTACGTCTCTACAGGCCTCATCTGGCT

Ensembl | nº de acceso humano

ENSG00000010671

Nº de acceso NCBI

NM_000061

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BTK(695) , BTK(695)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ADV
JUU
GBS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chandra Bose Prabaharan et al.
Investigational new drugs, 38(4), 909-921 (2019-08-04)
Treatment response rates to current anticancer therapies for HER2 overexpressing breast cancer are limited and are associated with severe adverse drug reactions. Tyrosine kinases perform crucial roles in cellular processes by mediating cell signalling cascades. Ibrutinib is a recently approved Tyrosine Kinase
E Slinger et al.
Leukemia, 31(12), 2601-2607 (2017-05-04)
The clinical success of B-cell receptor (BCR) signaling pathway inhibitors in chronic lymphocytic leukemia (CLL) is attributed to inhibition of adhesion in and migration towards the lymph node. Proliferation of CLL cells is restricted to this protective niche, but the
Agnieszka Krupa et al.
American journal of physiology. Lung cellular and molecular physiology, 307(6), L435-L448 (2014-08-03)
Previous observations made by our laboratory indicate that Bruton's tyrosine kinase (Btk) may play an important role in the pathophysiology of local inflammation in acute lung injury (ALI)/acute respiratory distress syndrome (ARDS). We have shown that there is cross talk
Genevra Pillinger et al.
Scientific reports, 5, 12949-12949 (2015-08-22)
Approximately 20% of patients with acute myeloid leukaemia (AML) have a mutation in FMS-like-tyrosine-kinase-3 (FLT3). FLT3 is a trans-membrane receptor with a tyrosine kinase domain which, when activated, initiates a cascade of phosphorylated proteins including the SRC family of kinases.
Angela Marina Montalbano et al.
European journal of pharmacology, 736, 35-43 (2014-05-07)
Cigarette smoke extract (CSE) affects the expression of Choline Acetyl-Transferase (ChAT), muscarinic acetylcholine receptors, and mucin production in bronchial epithelial cells. Mucin 5AC (MUC5AC), muscarinic acetylcholine receptor M3, ChAT expression, acetylcholine levels and acetylcholine binding were measured in a human
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico