Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU131171

Sigma-Aldrich

MISSION® esiRNA

targeting human USP7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACGTGACTTGCTCCCAGTTATGTGTGACAGAGCAGGATTTATTCAAGATACTAGCCTTATCCTCTATGAGGAAGTTAAACCGAATTTAACAGAGAGAATTCAGGACTATGACGTGTCTCTTGATAAAGCCCTTGATGAACTAATGGATGGTGACATCATAGTATTTCAGAAGGATGACCCTGAAAATGATAACAGTGAATTACCCACCGCAAAGGAGTATTTCCGAGATCTCTACCACCGCGTTGATGTCATTTTCTGTGATAAAACAATCCCTAATGATCCTGGATTTGTGGTTACGTTATCAAATAGAATGAATTATTTTCAGGTTGCAAAGACAGTTGCACAGAGGCTCAACACAGATCCAATGTTGCTGCAGTTTTTCAAGTCTCAAGGTTATAGGGATGGCCCAGGT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yufei Wang et al.
EMBO reports, 20(7), e47563-e47563 (2019-07-04)
Monoubiquitination of histone H2B on lysine 120 (H2Bub1) is an epigenetic mark generally associated with transcriptional activation, yet the global functions of H2Bub1 remain poorly understood. Ferroptosis is a form of non-apoptotic cell death characterized by the iron-dependent overproduction of
Eduardo de la Vega et al.
The FEBS journal, 287(21), 4659-4677 (2020-03-03)
Satellite cells (SCs) are myogenic progenitors responsible for skeletal muscle regeneration and maintenance. Upon activation, SCs enter a phase of robust proliferation followed by terminal differentiation. Underlying this myogenic progression, the sequential expression of muscle regulatory transcription factors (MRFs) and
Xiaomeng Dai et al.
Theranostics, 10(20), 9332-9347 (2020-08-18)
Background: Tumor associated macrophages (TAMs) have strong plasticity and if reprogrammed, can clear tumor cells and regulate the adaptive immune system for cancer immunotherapy. Deubiquitinating enzymes (DUBs), which can remove ubiquitin (Ub) from Ub-modified substrates, have been associated with oncogenic
Keith Wheaton et al.
The Journal of biological chemistry, 292(7), 2893-2902 (2017-01-12)
UbE2E1/UbcH6 is an E2 ubiquitin-conjugating enzyme that is regulated by USP7. We identified UbE2E1 as a novel component of Polycomb repressive complex 1 (PRC1), the E3 ligase complex responsible for histone H2A ubiquitination and gene silencing. We demonstrate that UbE2E1
Peiyi Xie et al.
Molecular and cellular endocrinology, 518, 111037-111037 (2020-09-24)
Ubiquitin-specific protease 7 (USP7/HAUSP) is known to regulate multiple cellular phenomena, including cell cycle progression and proliferation, and is involved in binding and stabilizing specific target proteins through deubiquitylation. However, the detailed role of USP7 in papillary thyroid carcinoma (PTC)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico