Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU130641

Sigma-Aldrich

MISSION® esiRNA

targeting human SORT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTCCTGGGTTGGAGATAGCACTGGGGTCATTCTAGTCTTGACTACCTTCCATGTACCACTGGTAATTATGACTTTTGGACAGTCCAAGCTATATCGAAGTGAGGATTATGGGAAGAACTTTAAGGATATTACAGATCTCATCAATAACACCTTTATTCGGACTGAATTTGGCATGGCTATTGGTCCTGAGAACTCTGGAAAGGTGGTGTTAACAGCAGAGGTGTCTGGAGGAAGTCGTGGAGGAAGAATCTTTAGATCATCAGATTTTGCGAAGAATTTTGTGCAAACAGATCTCCCTTTTCATCCTCTCACTCAGATGATGTATAGCCCTCAGAATTCTGATTATCTTTTAGCTCTCAGCACTGAAAATGGCCTGTGGGTGTCCAAGAATTTTGGGGGAAAATGGGAAGAAATCCACAAAGCAGTATGTTTGGCCAAATGGGGATCAGACAACACCATCTTCTTTACAACCTATGCAAATGGCTCCTG

Ensembl | nº de acceso humano

ENSG00000134243

Nº de acceso NCBI

NM_002959

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SORT1(6272) , SORT1(6272)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuncheng Lv et al.
Acta biochimica et biophysica Sinica, 51(5), 471-483 (2019-04-06)
Sortilin is closely associated with hyperlipidemia and the risk of atherosclerosis (AS). The role of sortilin and the underlying mechanism in peripheral macrophage are not fully understood. In this study, we investigated the effect of macrophage sortilin on ATP-binding cassette
Swati Venkat et al.
Molecular biology of the cell, 28(19), 2569-2578 (2017-08-05)
Elevated, nontoxic doses of manganese (Mn) protect against Shiga toxin-1-induced cell death via down-regulation of GPP130, a cycling Golgi membrane protein that serves as an endosome-to-Golgi trafficking receptor for the toxin. Mn binds to GPP130 in the Golgi and causes
Hye Youn Sung et al.
Journal of stroke, 20(3), 350-361 (2018-10-13)
The pathogenesis of moyamoya disease (MMD) remains poorly understood, and no reliable molecular biomarkers for MMD have been identified to date. The present study aimed to identify epigenetic biomarkers for use in the diagnosis of MMD. We performed integrated analyses
Keiji Uchiyama et al.
PLoS pathogens, 13(6), e1006470-e1006470 (2017-07-01)
Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains
Fangfang Gao et al.
The American journal of pathology, 190(9), 1931-1942 (2020-06-12)
Pancreatic cancer has a dismal prognosis, and there is no targeted therapy against this malignancy. The neuronal membrane protein sortilin is emerging as a regulator of cancer cell development, but its expression and impact in pancreatic cancer are unknown. This
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico