Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU127861

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF2AK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAGTTTGCCTTCCTGGATTTGTAAATTGTAATGACCTCAAAACTTTAGCAGTTCTTCCATCTGACTCAGGTTTGCTTCTCTGGCGGTCTTCAGAATCAACATCCACACTTCCGTGATTATCTGCGTGCATTTTGGACAAAGCTTCCAACCAGGATACGGGAAGAAGAAATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAGCAGGGAGT

Ensembl | nº de acceso humano

ENSG00000055332

Nº de acceso NCBI

NM_001135651

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EIF2AK2(5610) , EIF2AK2(5610)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tae-Hun Kim et al.
Molecular medicine reports, 16(5), 7585-7590 (2017-09-26)
Kisspeptin is a protein encoded by the KISS1 gene, which has been reported to suppress the metastatic capabilities of various types of cancer cells, through the activation of its G‑protein coupled receptor GPR54. However, the molecular mechanisms underlying the involvement
Jovan Nikolic et al.
PLoS pathogens, 12(10), e1005942-e1005942 (2016-10-18)
Stress granules (SGs) are membrane-less dynamic structures consisting of mRNA and protein aggregates that form rapidly in response to a wide range of environmental cellular stresses and viral infections. They act as storage sites for translationally silenced mRNAs under stress
Stephanie Dabo et al.
Scientific reports, 7(1), 16129-16129 (2017-11-25)
PKR is a cellular kinase involved in the regulation of the integrative stress response (ISR) and pro-inflammatory pathways. Two N-terminal dsRNA Binding Domains (DRBD) are required for activation of PKR, by interaction with either dsRNA or PACT, another cellular DRBD-containing
D C Tanner et al.
Cell death and differentiation, 22(9), 1489-1501 (2015-01-31)
Neuroinflammation associated with degenerative central nervous system disease and injury frequently results in oligodendrocyte death. While promoting oligodendrocyte viability is a major therapeutic goal, little is known about protective signaling strategies. We report that in highly purified rat oligodendrocytes, interferon

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico