Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU125691

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGGGGGCTTTACAATCCTAAGGTTGGCGTTGTAATGAAGTTCCACTTGGTTCAGGTTTCTTTGAACTGTGTGGTCTCAATTGGGAAAATATATTTCCTATACGTGTGTCTTTAAAAAAAAATGTGAACAGTGAACGTTTCGGTTGCTGTGACTGGGAAGTTGTTGGGTGTGCTTTTTCAGCCAGCTTCTCCTTCCACTGCT

Ensembl | nº de acceso humano

ENSG00000163251

Nº de acceso NCBI

NM_003468

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FZD5(7855) , FZD5(7855)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaozhu Liu et al.
International journal of clinical and experimental pathology, 13(5), 889-895 (2020-06-09)
To explore the effects of miR-149 on the cell proliferation and apoptosis of colorectal cancer (CRC) and its potential molecular mechanism. miR-149 expression patterns were detected in human CRC cell lines by quantitative real-time RT-PCR (Q-PCR). Online prediction software and
Qing-Zhi Long et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 7017-7026 (2015-04-12)
Renal cell carcinoma (RCC) is one of most malignant neoplasms, exhibiting poor responsiveness to the conventional chemo-regime. Abnormal expression of P-glycoprotein (P-gp) has been implicated in the emergence of multiple-drug resistance (MDR) by reducing the accumulation of intracellular chemotherapy drugs.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico