Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU123141

Sigma-Aldrich

MISSION® esiRNA

targeting human IFI27

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTAGGTCAGGGCCACGTAAATTCATTCAGGACAAGCACTGAGGTCAAACTCCCCAGTGATCCTCACCCTCCTCCAGAATTTCCACTTCCCGAAATGAAGCAAAGAGCGGTAGACAGGAGTCATCCCTTCTTGTGGCTCCCAACCTGGGGCAGCCCCCTGCCTCCCTTTAGATGGGCAATCGGCTTAGAAAGTGGAGGGGAAGCCAGTGTGGATCTACTCACAGAATGTTCTTTTGGTTTCCAGCCAGGATTGCTACAGTTGTGATTGGAGGAGTTGTGGCTGTGCCCATGGTGCTCAGTGCCATGGGCTTCACTGCGGCGGGAATCGCCTCGTCCTCCATAGCAGCCAAGATGATGTCCGCGGCGGCCATTGCCAATGGGGGTGGAGTTGCCTCGGGCAGCCTTGTGGCTACTCTGCAGTCACTGGGAGCAACTGGACTCTCCGGATTGACCAAGTTC

Ensembl | nº de acceso humano

ENSG00000165949

Nº de acceso NCBI

NM_001130080

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IFI27(3429) , IFI27(3429)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xing Liu et al.
Journal of medical virology, 89(7), 1215-1223 (2016-12-23)
Vaccination against the hepatitis B virus (HBV) is extensively used as an effective method to prevent HBV infection. However, nearly 10% of healthy adults fail to produce a protective level of antibodies against the hepatitis B vaccine, and multiple genetic
Jorge Domínguez-Andrés et al.
Cell metabolism, 29(1), 211-220 (2018-10-09)
Sepsis involves simultaneous hyperactivation of the immune system and immune paralysis, leading to both organ dysfunction and increased susceptibility to secondary infections. Acute activation of myeloid cells induced itaconate synthesis, which subsequently mediated innate immune tolerance in human monocytes. In contrast, induction

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico