Todas las fotos(1)

Documentos clave

Certificado de origen (COO)/COA

EHU122971

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human IRF7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTACACGGAGGAACTGCTGCGGCACGTGGCCCCTGGGTTGCACCTGGAGCTTCGGGGGCCACAGCTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGGTGGGCGGACCCCCAGGCTCCGCCAGCCCCTCCACCCCAGCCTGCCTGCTGCCTCGGAACTGTGACACCCCCATCTTCGACTTCAGAGTCTTCTTCCAAGAGCTGGTGGAATTCCGGGCACGGCAGCGCCGTGGCTCCCCACGCTATACCATCTACCTGGGCTTCGGGCAGGACCTGTCAGCTGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAGCTGGAACCCTGGCTGTGCCGAGTGCACCTAGAGGGCACGCAGCGTGAGGGTGTGTCTTCCCTGGATAGCAGCAGCCTCAGCCTCTGCCTGTCCAGCGCCAACAGCCTCTATGACGACATCGAGTGCTTCCTTATGGAGC

Ensembl | nº de acceso humano

ENSG00000185507

Nº de acceso NCBI

NM_001572

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IRF7(3665) , IRF7(3665)

Categorías relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Inhibitor of IkappaB kinase activity, BAY 11-7082, interferes with interferon regulatory factor 7 nuclear translocation and type I interferon production by plasmacytoid dendritic cells.

Rie Miyamoto et al.

Arthritis research & therapy, 12(3), R87-R87 (2010-05-18)

Plasmacytoid dendritic cells (pDCs) play not only a central role in the antiviral immune response in innate host defense, but also a pathogenic role in the development of the autoimmune process by their ability to produce robust amounts of type

IRF7 Is Required for the Second Phase Interferon Induction during Influenza Virus Infection in Human Lung Epithelia.

Wenxin Wu et al.

Viruses, 12(4) (2020-04-03)

Influenza A virus (IAV) infection is a major cause of morbidity and mortality. Retinoic acid-inducible protein I (RIG-I) plays an important role in the recognition of IAV in most cell types, and leads to the activation of interferon (IFN). We

Activation of interferon regulatory factor 7 in plasmacytoid dendritic cells promotes experimental autoimmune pancreatitis.

Kosuke Minaga et al.

Journal of gastroenterology, 55(5), 565-576 (2020-01-22)

Excessive type I IFN (IFN-I) production by plasmacytoid dendritic cells (pDCs) promotes autoimmunity. Recently, we reported that a prominent feature of both experimental autoimmune pancreatitis (AIP) and human type 1 AIP is pDC activation followed by enhanced production of IFN-I

Upregulation of PITX2 Promotes Letrozole Resistance Via Transcriptional Activation of IFITM1 Signaling in Breast Cancer Cells.

Ying-Ying Xu et al.

Cancer research and treatment : official journal of Korean Cancer Association, 51(2), 576-592 (2018-07-22)

Although the interferon α (IFNα) signaling and the paired-like homeodomain transcription factor 2 (PITX2) have both been implicated in the progression of breast cancer (BCa), it remains obscure whether these two pathways act in a coordinated manner. We therefore aimed

PU.1 acts as tumor suppressor for myeloma cells through direct transcriptional repression of IRF4.

N Ueno et al.

Oncogene, 36(31), 4481-4497 (2017-04-04)

We previously reported that PU.1 is downregulated in the majority of myeloma cell lines and primary myeloma cells of certain myeloma patients, and conditional expression of PU.1 in such myeloma cell lines induced cell cycle arrest and apoptosis. We found

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico