Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU119091

Sigma-Aldrich

MISSION® esiRNA

targeting human PERP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATAACTGGGCCTACGGCTTTGGGTGGGCAGCCACGATTATCCTGATTGGCTGTGCCTTCTTCTTCTGCTGCCTCCCCAACTACGAAGATGACCTTCTGGGCAATGCCAAGCCCAGGTACTTCTACACATCTGCCTAACTTGGGAATGAATGTGGGAGAAAATCGCTGCTGCTGAGATGGACTCCAGAAGAAGAAACTGTTTCTCCAGGCGACTTTGAACCCATTTTTTGGCAGTGTTCATATTATTAAACTAGTCAAAAATGCTAAAATAATTTGGGAGAAAATATTTTTTAAGTAGTGTTATAGTTTCATGTTTATCTTTTATTATGTTTTGTGAAGTTGTGTCTTTTCACTAATTACCTATACTATGCCAATATTTCCTTATATCTATCCATAACATTTATACTACATTTGTAAGAGAATATGCACGTGAA

Ensembl | nº de acceso humano

ENSG00000112378

Nº de acceso NCBI

NM_022121

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PERP(64065) , PERP(64065)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu Zhang et al.
Journal of cellular physiology, 234(7), 11330-11347 (2018-11-28)
Salmonella Enteritidis (SE) can be transmitted to eggs through cecum or the ovary from infected layers and causes food poisoning in humans. The mechanism of cecal transmission has been extensively studied. However, the mechanism and route of transovarian transmission of
Yu Zhang et al.
PeerJ, 7, e7663-e7663 (2019-10-01)
The zoonotic pathogen Salmonella not only reduces the production performance in ducks, but also poses a serious threat to human health through eggs and pollutes water bodies through feces. SipC, an effector protein of type III secretion systems (T3SS) in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico