Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU116731

Sigma-Aldrich

MISSION® esiRNA

targeting human CCL4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAACCAAAAGAAGCAAGCAAGTCTGTGCTGATCCCAGTGAATCCTGGGTCCAGGAGTACGTGTATGACCTGGAACTGAACTGAGCTGCTCAGAGACAGGAAGTCTTCAGGGAAGGTCACCTGAGCCCGGATGCTTCTCCATGAGACACATCTCCTCCATACTCAGGACTCCTCTCCGCAGTTCCTGTCCCTTCTCTTAATTTAATCTTTTTTATGTGCCGTGTTATTGTATTAGGTGTCATTTCCATTATTTATATTAGTTTAGCCAAAGGATAAGTGTCCCCTATGGGGATGGTCCACTGT

Ensembl | nº de acceso humano

ENSG00000129277

Nº de acceso NCBI

NM_002984

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CCL4(6351) , CCL4(6351)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Joo Hyun Kim et al.
Oncotarget, 8(3), 5361-5370 (2016-12-31)
Epstein-Barr virus (EBV)-encoded nuclear antigen, EBNA2, expressed in EBV-infected B lymphocytes is critical for lymphoblastoid cell growth. Microarray profiling and cytokine array screening revealed that EBNA2 is associated with upregulation of the chemokines CCL3 and CCL4 in lymphoma cells. Depletion
Ting-Ting Chang et al.
International journal of molecular sciences, 21(18) (2020-09-12)
Atherosclerosis is an arterial inflammatory disease. The circulating level of the C-C chemokine ligand (CCL4) is increased in atherosclerotic patients. This study aimed to investigate whether CCL4 inhibition could retard the progression of atherosclerosis. In ApoE knockout mice, CCL4 antibody

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico