Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU115631

Sigma-Aldrich

MISSION® esiRNA

targeting human EWSR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAGAGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGGCAGCGCTGGAGAGCGAGGTGGCTTCAATAAGCCTGGTGGACCCATGGATGAAGGACCAGATCTTGATCTAGGCCCACCTGTAGATCCAGATGAAGACTCTGACAACAGTGCAATTTATGTACAAGGATTAAATGACAGTGTGACTCTAGATGATCTGGCAGACTTCTTTAAGCAGTGTGGGGTTGTTAAGATGAACAAGAGAACTGGGCAACCCATGATCCACATCTACCTGGACAAGGAAACAGGAAAGCCCAAAGGCGATGCCACAGTGTCCTATGAAGACCCACCCACTGCCAAGGCTGCCGTGGAATGGTTTGATGGGAAAGATTTTCAAGGGAGCAAACTTAAAGTCTCCCTTGCTCGGA

Ensembl | nº de acceso humano

ENSG00000182944

Nº de acceso NCBI

NM_013986

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EWSR1(2130) , EWSR1(2130)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mizuki Azuma et al.
PloS one, 2(10), e979-e979 (2007-10-04)
The Ewing sarcoma breakpoint region 1 gene (EWSR1), also known as EWS, is fused to a number of different partner genes as a result of chromosomal translocation in diverse sarcomas. Despite the involvement of EWSR1 in these diverse sarcomas, the
Hyewon Park et al.
Cell cycle (Georgetown, Tex.), 13(15), 2391-2399 (2014-12-09)
Ewing sarcoma is a malignant bone cancer that primarily occurs in children and adolescents. Eighty-five percent of Ewing sarcoma is characterized by the presence of the aberrant chimeric EWS/FLI1 fusion gene. Previously, we demonstrated that an interaction between EWS/FLI1 and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico