Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU115141

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AACCGAACCACTCCAAGCTATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCTTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACCAATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Midori Ikezaki et al.
Biochemical and biophysical research communications, 527(2), 481-488 (2020-04-28)
Heat-shock cognate protein 70 (Hsc70), a molecular chaperone, is involved in multiple cellular functions. We previously demonstrated that Hsc70 is required for TGF-β-induced Smad signaling in mesenchymal-like NRK-49F cells. In the present study, to compare the Hsc70 functions in TGF-β-related
Ximeng Yang et al.
Scientific reports, 8(1), 11707-11707 (2018-08-05)
We previously found diosgenin, an herbal drug-derived steroid sapogenin, to be remarkably effective at restoring Aβ-induced axonal degeneration and improving memory function in model of Alzheimer's disease (AD), 5XFAD mouse. In this study, we investigated the downstream signaling of diosgenin
Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Guan Sun et al.
Journal of cellular biochemistry, 120(6), 10707-10714 (2019-03-01)
Migration and invasion are often recognized as the main reasons for the high recurrence and death rates of glioma and limit the efficacy of surgery and other antitumor therapies. In this study, we found over activation of heat shock cognate
Nerea Allende-Vega et al.
Scientific reports, 9(1), 5637-5637 (2019-04-06)
Eliminating mutant p53 (mt p53) protein could be a useful strategy to treat mt p53 tumors and potentially improve the prognosis of cancer patients. In this study, we unveil different mechanisms that eliminate p53-R248Q, one of the most frequent mutants

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico