Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU114171

Sigma-Aldrich

MISSION® esiRNA

targeting human FTH1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATC

Ensembl | nº de acceso humano

ENSG00000167996

Nº de acceso NCBI

NM_002032

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FTH1(2495) , FTH1(2495)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Katalin Éva Sikura et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(3), 413-431 (2019-02-01)
Objective- Calcific aortic valve disease is a prominent finding in elderly and in patients with chronic kidney disease. We investigated the potential role of iron metabolism in the pathogenesis of calcific aortic valve disease. Approach and Results- Cultured valvular interstitial
Vagisha Ravi et al.
PloS one, 14(9), e0221952-e0221952 (2019-09-07)
Elevated expression of the iron regulatory protein, ferritin heavy chain 1 (FTH1), is increasingly being associated with high tumor grade and poor survival outcomes in glioblastoma. Glioma initiating cells (GICs), a small population of stem-like cells implicated in therapeutic resistance
Caitlin W Brown et al.
Developmental cell, 51(5), 575-586 (2019-11-19)
Ferroptosis, regulated cell death characterized by the iron-dependent accumulation of lethal lipid reactive oxygen species, contributes to tissue homeostasis and numerous pathologies, and it may be exploited for therapy. Cells differ in their sensitivity to ferroptosis, however, and a key

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico