Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU113961

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACTGAAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAAGACTAGAGCAGCGAACTGCGACGATCACTTAGAGAAACAGGCCGTTAGGAATCCATTCTCACTGTGTTCGCTCTAAACAAAACAGTGGTAGGTTAATGTGTTCAGAAGTCGCTGTCCTT

Ensembl | nº de acceso humano

ENSG00000116288

Nº de acceso NCBI

NM_007262

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PARK7(11315) , PARK7(11315)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bijun Qiu et al.
Oncotarget, 8(5), 8499-8511 (2016-12-31)
Chronic liver inflammation and injuries play a critical role in development of hepatocellular carcinoma (HCC). Parkinson disease (autosomal recessive, early onset) 7, encoding PARK7 protein (also called DJ-1), plays important roles in many carcinogenesis processes and is essential in modulating
Prahlad V Raninga et al.
Apoptosis : an international journal on programmed cell death, 21(12), 1422-1437 (2016-10-28)
Multiple myeloma (MM) is an incurable plasma B cell malignancy. Despite recent advancements in anti-MM therapies, development of drug resistance remains a major clinical hurdle. DJ-1, a Parkinson's disease-associated protein, is upregulated in many cancers and its knockdown suppresses tumor
Canan Schumann et al.
Molecular pharmaceutics, 13(6), 2070-2083 (2016-05-14)
We report an efficient therapeutic modality for platinum resistant ovarian cancer based on siRNA-mediated suppression of a multifunctional DJ-1 protein that is responsible for the proliferation, growth, invasion, oxidative stress, and overall survival of various cancers. The developed therapeutic strategy
Hua-Zong Zeng et al.
International journal of molecular sciences, 12(6), 3489-3499 (2011-07-13)
The aim of study is to identify cisplatin-resistance associated biomarkers for non-small cell lung cancers (NSCLC). We use two-dimensional electrophoresis (2-DE) combined with MALDI-TOF mass spectrometry to compare the proteome between lung cancer cell line A549 and its cisplatin-resistant subline
Karim Bahmed et al.
American journal of physiology. Lung cellular and molecular physiology, 317(4), L475-L485 (2019-07-18)
The alveolus participates in gas exchange, which can be impaired by environmental factors and toxins. There is an increase in using electronic cigarettes (e-cigarettes); however, their effect on human primary alveolar epithelial cells is unknown. Human lungs were obtained from
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico