Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU113781

Sigma-Aldrich

MISSION® esiRNA

targeting human OLA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAATTAAACCACCCCCAATCATTGGAAGATTTGGAACCTCACTGAAAATTGGTATTGTTGGATTGCCAAATGTTGGGAAATCTACTTTCTTCAATGTGTTAACCAATAGTCAGGCTTCAGCAGAAAACTTCCCGTTCTGCACTATTGATCCTAATGAGAGCAGAGTACCTGTGCCAGATGAAAGGTTTGACTTTCTTTGTCAATACCACAAACCAGCAAGCAAAATTCCTGCCTTTCTAAATGTGGTGGATATTGCTGGCCTTGTGAAAGGAGCTCACAATGGGCAGGGCCTGGGGAATGCTTTTTTATCTCATATTAGTGCCTGTGATGGCATCTTTCATCTAACACGTGCTTTTGAAGATGATGATATCACGCACGTTGAAGGAAGTGTAGATCCTATTCGAGATATAGAAATAATACATGAAGAGCTTCAGCTTAAAGATGAGGAAATGATTGGGC

Ensembl | nº de acceso humano

ENSG00000138430

Nº de acceso NCBI

NM_001011708

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... OLA1(29789) , OLA1(29789)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Elia Martínez-Baeza et al.
Mutagenesis, 31(4), 463-473 (2016-03-18)
Environmental pollutants are complex mixtures in which metals are ubiquitous. Metal mixtures of arsenic, cadmium and lead are present in the occupational environment and generate health effects such as cardiovascular, renal and cancer diseases. Cell transformation induced by metal mixtures
Jianzhou Liu et al.
BMC molecular and cell biology, 21(1), 65-65 (2020-09-16)
The human Obg-like ATPase 1 (OLA1) protein has been reported to play an important role in cancer cell proliferation. The molecular mechanism underlying OLA1 regulated oral metastasis is still unknown. We investigated in this study the regulatory role of OLA1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico