Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU108911

Sigma-Aldrich

MISSION® esiRNA

targeting human RAD21

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGATGGCGGTATCTTTGATGATCCCCCTGCCCTCTCTGAGGCAGGGGTGATGTTGCCAGAGCAGCCTGCACATGACGATATGGATGAGGATGATAATGTATCAATGGGTGGGCCTGATAGTCCTGATTCAGTGGATCCCGTTGAACCAATGCCAACCATGACTGATCAAACAACACTTGTTCCAAATGAGGAAGAAGCATTTGCATTGGAGCCTATTGATATAACTGTTAAAGAAACAAAAGCCAAGAGGAAGAGGAAGCTAATTGTTGACAGTGTCAAAGAGTTGGATAGCAAGACAATTAGAGCCCAACTTAGTGATTATTCAGATATTGTTACTACTTTGGATCTGGCACCGCCCACCAAGAAATTGATGATGTGGAAAGAGACAGGAGGAGTAGAAAAACTGTTTTCTTTACCTGCTCAGCCTTTGTGGAATAACAGACTACTGAAGCTCTTTACACGCTGTCTTACACCGC

Ensembl | nº de acceso humano

ENSG00000164754

Nº de acceso NCBI

NM_006265

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RAD21(5885) , RAD21(5885)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yukinori Terada et al.
Cell reports, 26(10), 2608-2621 (2019-03-07)
Atypical teratoid/rhabdoid tumor (AT/RT), which harbors SMARCB1 mutation and exhibits a characteristic histology of rhabdoid cells, has a poor prognosis because of the lack of effective treatments. Here, we establish human SMARCB1-deficient pluripotent stem cells (hPSCs). SMARCB1-deficient hPSC-derived neural progenitor-like cells
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico