Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU106841

Sigma-Aldrich

MISSION® esiRNA

targeting human DENR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAGGAACAGTGCCAAGTTAGATGCCGATTACCCACTTCGAGTCCTTTATTGTGGAGGCAAGTGTTGTTTCCCCACCTGGTACTGTGAATATATGCCTGATGTTGCTAAATGTAGACAATGGTTAGAGAAGAATTTTCCAAATGAATTTGCAAAACTTACTGTAGAAAATTCACCCAAACAAGAAGCTGGAATTAGTGAGGGTCAAGGAACAGCAGGGGAAGAAGAGGAGAAGAAAAAACAGAAGAGAGGTGGAAGGGGTCAAATAAAACAAAAAAAGAAGACCGTACCACAAAAGGTTACTATAGCCAAAATTCCCAGAGCAAAGAAGAAATATGTGACAAGAGTATGTGGCCTTGCAACTTTTGAAATTGATCTTAAAGAAGCACAAAGATTTTTTGCTCAAAAATTCTCCTGTGGTGCCTCAG

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Deepika Vasudevan et al.
Nature communications, 11(1), 4677-4677 (2020-09-18)
The Integrated Stress Response (ISR) helps metazoan cells adapt to cellular stress by limiting the availability of initiator methionyl-tRNA for translation. Such limiting conditions paradoxically stimulate the translation of ATF4 mRNA through a regulatory 5' leader sequence with multiple upstream
Guobing Li et al.
Oncotarget, 6(3), 1834-1849 (2015-01-18)
Cofilin is a member of the actin-depolymerizing factor (ADF) family protein, which plays an essential role in regulation of the mitochondrial apoptosis. It remains unclear how cofilin regulates the mitochondrial apoptosis. Here, we report for the first time that natural

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico