Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU104701

Sigma-Aldrich

MISSION® esiRNA

targeting human CLIC4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCAGAGGCTCTTCATGATTCTTTGGCTCAAAGGAGTTGTATTTAGTGTGACGACTGTTGACCTGAAAAGGAAGCCAGCAGACCTGCAGAACTTGGCTCCCGGGACCCACCCACCATTTATAACTTTCAACAGTGAAGTCAAAACGGATGTAAATAAGATTGAGGAATTTCTTGAAGAAGTCTTATGCCCTCCCAAGTACTTAAAGCTTTCACCAAAACACCCAGAATCAAATACTGCTGGAATGGACATCTTTGCCAAATTCTCTGCATATATCAAGAATTCAAGGCCAGAGGCTAATGAAGCACTGGAGAGGGGTCTCCTGAAAACCCTGCAGAAACTGGATGAATATCTGAATTCTCCTCTCCCTGATGAAATTGATGAAAATAGTATGGAGGACATAAAGTTTTCTACACGTAAATTTCTGGATGGCAATGAAATGA

Ensembl | nº de acceso humano

ENSG00000169504

Nº de acceso NCBI

NM_013943

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CLIC4(25932) , CLIC4(25932)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qiu-Yun Yu et al.
Journal of cellular biochemistry, 119(1), 659-668 (2017-06-22)
This study explored the effects involved in silencing CLIC4 on apoptosis and proliferation of mouse liver cancer Hca-F and Hca-P cells. A CLIC4-target small interfering RNA (siRNA) was designed to compound into two individual complementary oligonucleotide chains. A process of
Baolong Wang et al.
Carcinogenesis, 41(6), 841-849 (2019-09-29)
Chloride intracellular channel protein 4 (CLIC4) has been implicated in different types of cancers, but the role of CLIC4 in the development of gastric cancer (GC) remains unknown. We analyzed the expression of CLIC4 in 102 pairs of gastric adenocarcinomas
Wei Guo et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 9049-9057 (2015-06-19)
A recent study reported that miR-570 was the most important microRNA in the microRNA gene networks of alcoholic liver disease that has the potential of progressing to hepatocellular carcinoma. However, litter is known regarding the expression and specific function of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico