Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU104541

Sigma-Aldrich

MISSION® esiRNA

targeting human AKR1C3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATTTGGCACCTATGCACCTCCAGAGGTTCCGAGAAGTAAAGCTTTGGAGGTCACAAAATTAGCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAACTCACTGAAGAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATGTCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGACATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATTGGGGTGTCAAA

Ensembl | nº de acceso humano

ENSG00000196139

Nº de acceso NCBI

NM_003739

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AKR1C3(8644) , AKR1C3(8644)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
ULU
OXS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yoshitaka Sekine et al.
Oncology letters, 15(3), 3167-3172 (2018-02-13)
Statins have become of interest in research due to their anticancer effects. However, the exact mechanism of their anticancer properties remains unclear. The authors previously reported that statins decrease intracellular cholesterol levels in androgen-independent prostate cancer cells. In de novo
Melanie M Erzinger et al.
PloS one, 11(3), e0150219-e0150219 (2016-03-08)
The chemoprotective properties of sulforaphane (SF), derived from cruciferous vegetables, are widely acknowledged to arise from its potent induction of xenobiotic-metabolizing and antioxidant enzymes. However, much less is known about the impact of SF on the efficacy of cancer therapy
Chengfei Liu et al.
Molecular cancer therapeutics, 18(10), 1875-1886 (2019-07-17)
The mechanisms resulting in resistance to next-generation antiandrogens in castration-resistant prostate cancer are incompletely understood. Numerous studies have determined that constitutively active androgen receptor (AR) signaling or full-length AR bypass mechanisms may contribute to the resistance. Previous studies established that
Chengfei Liu et al.
Molecular cancer therapeutics, 16(1), 35-44 (2016-10-30)
Abiraterone suppresses intracrine androgen synthesis via inhibition of CYP17A1. However, clinical evidence suggests that androgen synthesis is not fully inhibited by abiraterone and the sustained androgen production may lead to disease relapse. In the present study, we identified AKR1C3, an

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico