Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU102491

Sigma-Aldrich

MISSION® esiRNA

targeting human ADGRG1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTCCTGAAGCCCTCTTGTGGCAAGAACTGTGGACCATGCCAGTCCCGTCTGGTTTCCATCCCACCACTCCAAGGACTGAGACTGACCTCCTCTGGTGACACTGGCCTAGGGCCTGACACTCTCCTAAGAGGTTCTCTCCAAGCCCCCAAATAGCTCCAGGCGCCCTCGGCCGCCCATCATGGTTAATTCTGTCCAACAAACACACACGGGTAGATTGCTGGCCTGTTGTAGGTGGTAGGGACACAGATGACCGACCTGGTCACTCCTCCTGCCAACATTCAGTCTGGTATGTGAGGCGTGCGTGAAGCAAGAACTCCTGGAGCTACAGGGACAGGGAGCCATCATTCCTGCCTGGGAATCCTGGAAGACTTCCTGCAGGAGTCAGCGTTCAATCTTGACCTTGAAGATGGGAAGGATGT

Ensembl | nº de acceso humano

ENSG00000205336

Nº de acceso NCBI

NM_005682

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ADGRG1(9289) , GPR56(9289)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tomoya Kitakaze et al.
Biochimica et biophysica acta. Molecular cell research, 1867(2), 118563-118563 (2019-11-02)
Skeletal muscle secretes biologically active proteins that contribute to muscle hypertrophy in response to either exercise or dietary intake. The identification of skeletal muscle-secreted proteins that induces hypertrophy can provide critical information regarding skeletal muscle health. Dietary provitamin A, β-carotene
Zahida Yesmin Roly et al.
The Journal of endocrinology, 244(2), 395-413 (2019-12-13)
The embryonic Müllerian ducts give rise to the female reproductive tract (fallopian tubes, uterus and upper vagina in humans, the oviducts in birds). Embryonic Müllerian ducts initially develop in both sexes, but later regress in males under the influence of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico