Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU098321

Sigma-Aldrich

MISSION® esiRNA

targeting human SYF2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCACATTTTTGTGCTTGGATATAAGATGTATTTCTTGTAGTGAAGTTGTTTTGTAATCTACTTTGTATACATTCTAATTATATTATTTTTCTATGTATTTTAAATGTATATGGCTGTTTAATCTTTGAAGCATTTTGGGCTTAAGATTGCCAGCAGCACACATCAGATGCAGTCATTGTTGCTATCAGTGTGGAATTTGATAGAGTCTAGACTCGGGCCACTTGGAGTTGTGTACTCCAAAGCTAAGGACAGTGATGAGGAAGATGGCA

Ensembl | nº de acceso humano

ENSG00000117614

Nº de acceso NCBI

NM_015484

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SYF2(25949) , SYF2(25949)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Youmao Tao et al.
Archives of biochemistry and biophysics, 688, 108406-108406 (2020-05-18)
Increasing evidence indicates that aberrantly expressed microRNAs play a role in tumorigenesis and progression of gastric cancer. Recently, a novel cancer-related microRNA, miR-621, was found to be involved in cancer pathogenesis. However, the precise molecular mechanisms underlying the oncogenic activity
Feng Shi et al.
Oncotarget, 8(51), 88453-88463 (2017-11-29)
SYF2, a known cell cycle regulator, is reported to be involved in cell cycle arrest by interacting with cyclin-D-type binding protein 1. In the present study, we investigated the role of SYF2 in human breast cancer (BC) progression. SYF2 was
Chia-Hsin Chen et al.
PloS one, 7(3), e33538-e33538 (2012-03-27)
Human p29 is a putative component of spliceosomes, but its role in pre-mRNA is elusive. By siRNA knockdown and stable overexpression, we demonstrated that human p29 is involved in DNA damage response and Fanconi anemia pathway in cultured cells. In

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico