Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU097551

Sigma-Aldrich

MISSION® esiRNA

targeting human TET3 (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCTTTGGTTGTTCCTGGAGCATGTACTTCAACGGCTGCAAGTATGCTCGGAGCAAGACACCTCGCAAGTTCCGCCTCGCAGGGGACAATCCCAAAGAGGAAGAAGTGCTCCGGAAGAGTTTCCAGGACCTGGCCACCGAAGTCGCTCCCCTGTACAAGCGACTGGCCCCTCAGGCCTATCAGAACCAGGTGACCAACGAGGAAATAGCGATTGACTGCCGTCTGGGGCTGAAGGAAGGACGGCCCTTCGCGGGGGTCACGGCCTGCATGGACTTCTGTGCCCACGCCCACAAGGACCAGCATAACCTCTACAATGGGTGCACC

Ensembl | nº de acceso humano

ENSG00000187605

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TET3(200424) , TET3(200424)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
STU
DBT
CTS
QQS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Liang-Qi Cao et al.
Molecular cancer, 18(1), 148-148 (2019-10-28)
As an important means of communication, exosomes play an important role in the development of hepatocellular carcinoma (HCC). Bioinformatics analysis, dual-luciferase reporter assays, methylation-specific quantitative PCR, and ChIP-PCR analysis were used to gain insight into the underlying mechanism of miR-21
Jie Li et al.
Journal of Cancer, 12(1), 207-216 (2021-01-05)
Background: Berberine, as an alkaloid, has a significant antitumor effect, but its mechanism in tumor metabolism, especially the Warburg effect has not been elucidated. Objectives: To study the molecular mechanism of berberine regulating the Warburg effect in ovarian cancer cells.
Suhas S Kharat et al.
Science signaling, 13(645) (2020-08-21)
Synthetic lethality between poly(ADP-ribose) polymerase (PARP) inhibition and BRCA deficiency is exploited to treat breast and ovarian tumors. However, resistance to PARP inhibitors (PARPis) is common. To identify potential resistance mechanisms, we performed a genome-wide RNAi screen in BRCA2-deficient mouse

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico