Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU097521

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACCAGAAGCGAAGGTCACAAAAGATAACAGGAAGTCCAACCTTAGTAAAAAATATACCTACCAGTTTAGGCTATGGAGCAGCTCTTAATGCCAGTTTGCAGGCTGCCTTGGCAGAGAGCAGTTTACCTTTGCTAAGTAATCCTGGACTGATAAATAATGCATCCAGTGGCCTACTGCAGGCCGTCCACGAAGACCTCAATGGTTCTCTGGATCACATTGACAGCAATGGAAACAGTAGTCCGGGCTGCTCACCTCAGCCGCACATACATTCAATCCACGTCAAGGAAGAGCCAGTGATTGCAGAGGATGAAGACTGCCCAATGT

Ensembl | nº de acceso humano

ENSG00000128573

Nº de acceso NCBI

NM_148899

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FOXP2(93986) , FOXP2(93986)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

W-X Wang et al.
European review for medical and pharmacological sciences, 23(15), 6467-6477 (2019-08-06)
Colorectal carcinoma (CRC) is a common malignant tumor of the digestive tract that occurs in the colon, and the incidence is the third in the gastrointestinal tumor. Recently, the dysregulated expression of microRNA-9 (miR-9) has been identified in many human
Yixiao Liu et al.
International journal of molecular sciences, 21(6) (2020-03-19)
Diabetes mellitus is a growing global health issue nearly across the world. Diabetic patients who are prone to develop diabetes-related complications often exhibit progressive neuropathy (painless and sensory loss). It is usual for small wounds to progress to ulceration, which

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico